Sars-Cov-2

Introduction

Material and recipes 

Data and results,   even more data

Summary

 

 Introduction

As the Covid-19 pandemic hit Norway in the march 2020 the health authorities dedicated funds to increase research on the topic.  Since the testing strategy for Sars-Cov-2 virus had been established by cDNA synthesis from virus RNA and detection by Taqman PCR the need for chemistry was evident. Furthermore, a supply shortage from commercial sources was observed. Thus, if in-house enzyme, reverse transcriptase and Taq polymerase could be produced and tested, that could potentially be beneficial. 

Primers and probes published from different labs was extracted from the World Health Organization (WHO) webpage and used for testing of in-house chemistry. Several assays that detect the 2019-nCoV have been development. Some assays may detect only the novel virus and some may also detect other strains (e.g. SARS-CoV) that are genetically similar. Common for the assays were the detection method by rtPCR with "Syber Green" or with TaqMan probe.

Molecular assays to diagnose 2019-nCoV

Source 

Links and primer "name" Annealing Primer set #

"Forward"

"Reverse"

"Probe"

Reporter dye 5' - 3' Quencher
Source            
ORF1ab            
ORF1ab(F)   1 F   CCCTGTGGGTTTTACACTTAA   
ORF1ab(R)   1 R   ACGATTGTGCATCAGCTGA   
ORF1ab(P)   1 P FAM- CCGTCTGCGGTATGTGGAAAGGTTATGG BHQ1
N-gene            
N(F)   2 F   GGGGAACTTCTCCTGCTAGAAT   
N(R)   2 R   CAGACATTTTGCTCTCAAGCTG   
N(P)   2 P FAM- TTGCTGCTGCTTGACAGATT TAMRA
Source            
RdRP_SARSr-F2 58°C 3 F   GTGARATGGTCATGTGTGGCGG  
RdRP_SARSr-R1   3 R   CARATGTTAAASACACTATTAGCATA  
RdRP_SARSr-P2   3 P FAM- CAGGTGGAACCTCATCAGGAGATGC BBQ
RdRP_SARSr-P1   3 P FAM- CCAGGTGGWACRTCATCMGGTGATGC BBQ
E_Sarbeco_F1   4 F   ACAGGTACGTTAATAGTTAATAGCGT  
E_Sarbeco_R2   4 R   ATATTGCAGCAGTACGCACACA  
E_Sarbeco_P1   4 P FAM- ACACTAGCCATCCTTACTGCGCTTCG BBQ
Source            
Assay 1 (Target: ORF1b-nsp14)            
(HKU-ORF1b-nsp14F):   5 F   TGGGGYTTTACRGGTAACCT  
(HKU-ORF1b-nsp14R):   5 R   AACRCGCTTAACAAAGCACTC  
(HKU-ORF1b-nsp141P):   5 P FAM- TAGTTGTGATGCWATCATGACTAG TAMRA
Assay 2 (Target: N)            
(HKU-NF)   6 F   TAATCAGACAAGGAACTGATTA  
(HKU-NR)   6 R   CGAAGGTGTGACTTCCATG  
Probe (HKU-NP):   6 P FAM- GCAAATTGTGCAATTTGCGG TAMRA
Source            
WH-NIC N-F   7 F   CGTTTGGTGGACCCTCAGAT  
WH-NIC N-R   7 R   CCCCACTGCGTTCTCCATT  
WH-NIC N-P   7 P FAM- CAACTGGCAGTAACCA BHQ1
Source            
ORF1a set            
NIID_WH-1_F501 60°C  8 F   TTCGGATGCTCGAACTGCACC  
NIID_WH-1_R913   8 R   CTTTACCAGCACGTGCTAGAAGG  
NIID_WH-1_F509 60°C  9 F   CTCGAACTGCACCTCATGG  
NIID_WH-1_R854   9 R   CAGAAGTTGTTATCGACATAGC  
NIID_WH-1_Seq_F519 60°C  10 F   ACCTCATGGTCATGTTATGG  
NIID_WH-1_Seq_R840   10 R   GACATAGCGAGTGTATGCC  
S set            
WuhanCoV-spk1-f 60°C  11 F   TTGGCAAAATTCAAGACTCACTTT  
WuhanCoV-spk2-r   11 R   TGTGGTTCATAAAAATTCCTTTGTG  
NIID_WH-1_F24381 60°C  12 F   TCAAGACTCACTTTCTTCCAC  
NIID_WH-1_R24873   12 R   ATTTGAAACAAAGACACCTTCAC  
NIID_WH-1_Seq_F24383 60°C  13 F   AAGACTCACTTTCTTCCACAG  
NIID_WH-1_Seq_R24865   13 R   CAAAGACACCTTCACGAGG  
             
NIID_2019-nCOV_N_F2 60°C  14 F   AAATTTTGGGGACCAGGAAC  
NIID_2019-nCOV_N_R2   14 R   TGGCAGCTGTGTAGGTCAAC  
NIID_2019-nCOV_N_P2   14 P FAM- ATGTCGCGCATTGGCATGGA  
Source            
2019-nCoV_N1-F 55°C 15 F   GACCCCAAAATCAGCGAAAT  
2019-nCoV_N1-R   15 R   TCTGGTTACTGCCAGTTGAATCTG  
2019-nCoV_N1-P   15 P FAM- ACCCCGCATTACGTTTGGTGGACC BHQ1
2019-nCoV_N2-F 55°C 16 F   TTACAAACATTGGCCGCAAA  
2019-nCoV_N2-R   16 R   GCGCGACATTCCGAAGAA  
2019-nCoV_N2-P   16 P FAM- ACAATTTGCCCCCAGCGCTTCAG BHQ1
2019-nCoV_N3-F 55°C 17 F   GGGAGCCTTGAATACACCAAAA  
2019-nCoV_N3-R   17 R   TGTAGCACGATTGCAGCATTG  
2019-nCoV_N3-P   17 P FAM- AYCACATTGGCACCCGCAATCCTG BHQ1
RNAse-RP-F 55°C 18 F   AGATTTGGACCTGCGAGCG  
RNAse-RP-R   18 R   GAGCGGCTGTCTCCACAAGT  
RNAse-RP-P   18 P FAM- TTCTGACCTGAAGGCTCTGCGCG BHQ1
Source            
RdRp gene/nCov_IP2            
nCoV_IP2-12669Fw 58°C 19 F   ATGAGCTTAGTCCTGTTG  
nCoV_IP2-12759Rv   19 R   CTCCCTTTGTTGTGTTGT  
nCoV_IP2-12696bProbe(+)   19 P HEX- AGATGTCTTGTGCTGCCGGTA BHQ1
RdRp            
nCoV_IP4-14059Fw 58°C 20 F   GGTAACTGGTATGATTTCG  
nCoV_IP4-14146Rv   20 R   CTGGTCAAGGTTAATATAGG  
nCoV_IP4-14084Probe(+)   20 P FAM- TCATACAAACCACGCCAGG BHQ1
E_gene / E_Sarbeco            
E_Sarbeco_F1 58°C 21 F   ACAGGTACGTTAATAGTTAATAGCGT  
E_Sarbeco_R2   21 R   ATATTGCAGCAGTACGCACACA  
E_Sarbeco_P1   21 P FAM- ACACTAGCCATCCTTACTGCGCTTCG BHQ1

 

Location of primers

The location of the primers and probes are mapped with https://www.bioinformatics.org/sms2/primer_map.html and can be viewed in this PDF. Some of the primers in the table above does not match the NCBI Reference Sequence: NC_045512.2

 

Introduction

Material and recipes 

Data and results,   even more data

Summary

Link description

Molecular assays to diagnose 2019-nCoV
https://www.who.int/docs/default-source/coronaviruse/whoinhouseassays.pdf?sfvrsn=de3a76aa_2
Several assays that detect the 2019-nCoV have been and are currently under development, both in-house and commercially. Some assays may detect only the novel virus and some may also detect other strains (e.g. SARS-CoV) that are genetically similar.
China CDC, China, National Institute for viral desease control and prevention
http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html
Victor Corman, Tobias Bleicker, Sebastian Brünink, Christian Drosten Charité Virology, Berlin, Germany
https://www.who.int/docs/default-source/coronaviruse/protocol-v2-1.pdf?sfvrsn=a9ef618c_2
School of Public Health, The University of Hong Kong, Hong Kong
https://www.who.int/docs/default-source/coronaviruse/peiris-protocol-16-1-20.pdf?sfvrsn=af1aac73_4
Department of Medical Sciences, Ministry of Public Health, Thailand.
https://www.who.int/docs/default-source/coronaviruse/conventional-rt-pcr-followed-by-sequencing-for-detection-of-ncov-rirl-nat-inst-health-t.pdf?sfvrsn=42271c6d_4
National Institute of Infectious Diseases, Japan
https://www.who.int/docs/default-source/coronaviruse/method-niid-20200123-2.pdf?sfvrsn=fbf75320_7
DEPARTMENT OF HEALTH & HUMAN SERVICES, Centers for Disease Control and Prevention (CDC), USA
https://www.who.int/docs/default-source/coronaviruse/uscdcrt-pcr-panel-primer-probes.pdf?sfvrsn=fa29cb4b_2
Institut Pasteur, Paris, France
https://www.who.int/docs/default-source/coronaviruse/real-time-rt-pcr-assays-for-the-detection-of-sars-cov-2-institut-pasteur-paris.pdf?sfvrsn=3662fcb6_2



 
Page visits: 474